Đăng nhập
Tư liệu

Tư liệu KH&CN

Nghiên cứu nuôi trồng nấm Linh chi đỏ Quốc Oai, Đạ Tẻh góp phần bảo tồn nguồn gen nấm dược liệu tại Lâm Đồng
Ấn phẩm KHCN
Khoa học công nghệ
KS. Thái Thị Thanh Thủy, ThS. Phan Quốc Chính, ThS. Trần Thị Mỹ Linh, ThS. Lường Tú Nam, ThS. Nguyễn Như Chương - Trung tâm Ứng dụng khoa học và công nghệ Lâm Đồng
2020
Một số tài liệu bạn cần đăng nhập với tư cách thành viên thì mới có thể tải toàn văn nội dung vê theo luật sở hữu trí tuệ.
Cho phép tải công cộng

Mở đầu

Nấm Linh chi còn gọi là nấm Trường thọ, nấm Lim; gồm nhiều loài thuộc họ Ganodermataceae Donk, bộ Ganodermatales, lớp Hymenomycetes, ngành phụ Basidiomycotina, giới nấm Fungi.

Lê Xuân Thám, 1996, 1998, đã kết hợp phân tích tiến hóa cấu trúc bào tử đảm và cấu trúc rDNA đã bổ sung dẫn liệu hệ thống học tiến hóa họ Linh chi Ganodermataceae Donk với các kiểu bào tử đảm đặc thù. [6, 7]        

S. Singh và cộng sự, 2014, nghiên cứu cho thấy hệ sợi nấm Linh chi Ganoderma lucidum phát triển tốt trên môi trường Potato Dextrose Agar (PDA), trong điều kiện nuôi cấy ở nhiệt độ 25 ± 2o​C. [4]

S. Roy và cộng sự, 2015, đã công bố công trình nghiên cứu Linh chi đỏ Ganoderma lucidum: nhân giống cấp I trên môi trường PDA ở 25oC trong 7-10 ngày; nuôi trồng trên mùn cưa với độ ẩm cơ chất 65%, có bổ sung 8% cám gạo + cám bắp và 2% CaCO3; nuôi sợi trong tối ở 25oC; nuôi trồng ra quả thể ở 25-32oC, độ ẩm không khí 85-95%, ánh sáng 250-350 lux. [5]

Ngô Anh và cộng sự, 2008, đã nghiên cứu thành công khu hệ nấm lớn ở Thừa Thiên - Huế; trong đó, họ Ganodermataceae chiếm đến 36 loài; đặc biệt, tác giả đã nghiên cứu nuôi trồng một số loài nấm Linh chi trên các nghiệm thức mùn cưa. Kết quả cho thấy, nuôi trồng trên mùn cưa keo tai tượng đạt hiệu suất sinh học cao nhất. [1]

A. Trigos và J. S. Medellin, 2011, đã có công bố trong quả thể nấm Linh chi thuộc chi Ganoderma có 140 loại triterpenoid và 200 loại polysaccharide. [2]

Florey, 1949, đã nghiên cứu tách chiết hoạt chất Oregonensin (C20H32O8) từ loài nấm Linh chi Ganoderma oregonense có khả năng ức chế sự phát triển của vi khuẩn Gram (+), tụ cầu khuẩn (Staphylococcus aureus) và vi khuẩn Mycobacterium phlei lây bệnh trên người.

Nguyễn Như Chương và cộng sự, 2016, đã công bố kết quả phân tích một số hoạt chất chính của nấm Linh chi đỏ Đà Lạt (Ganoderma lucidum) nuôi trồng trên mùn cưa cao su. [3]

Trong chuyến khảo sát thực địa phục vụ công tác sưu tập, bảo tồn nguồn gen nấm, đã phát hiện mẫu nấm Linh chi đỏ mọc trên cây gỗ Trắc tại xã Quốc Oai, huyện Đạ Tẻh. Những năm gần đây, người dân địa phương đã tận thu mẫu nấm Linh chi này ngoài tự nhiên bán với giá ≈ 600.000 đồng/kg nấm khô; dẫn đến nguồn gen nấm dược liệu này có nguy cơ cạn kiệt, gây tổn thất nguồn gen. Do đó, việc nghiên cứu bảo tồn và từng bước phát triển loài nấm Linh chi đỏ là nhiệm vụ cấp thiết, nhằm góp phần quan trọng trong việc bảo tồn đa dạng sinh học và phục vụ phát triển kinh tế - xã hội địa phương.

Vật liệu và phương pháp nghiên cứu

Vật liệu

Mẫu nấm Linh chi đỏ được thu thập trên cây gỗ Trắc tại xã Quốc Oai, huyện Đạ Tẻh, Lâm Đồng (ký hiệu: LC-QA). Sau đó, đưa về Trạm Thực nghiệm của Trung tâm Ứng dụng khoa học và công nghệ (Sở Khoa học và Công nghệ tỉnh Lâm Đồng) để tiến hành nghiên cứu.

Phương pháp

Phân tích hình thái

Mẫu nấm được chụp ảnh, phân tích hình thái, quan sát hệ sợi dưới kính hiển vi quang học.

Tách phân lập giống

Phân lập mẫu nấm Linh chi đỏ Quốc Oai bằng phương pháp tách mô thịt nấm trên môi trường PDA, pH = 6; hấp khử trùng ở 121oC trong 15 phút.

Phân tích ITS-rDNA

Mẫu nấm được gửi phân tích ITS-rDNA tại Viện Công nghệ Sinh học. Kết quả trình tự được so sánh với trình tự chuẩn trong GenBank bằng công cụ BLAST của NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Nhân giống nấm, nuôi trồng ra quả thể

Nhân giống nấm nguyên chủng trên môi trường thạch nghiêng PDA; nuôi cấy ở nhiệt độ 30oC để lưu giữ, phục vụ nghiên cứu.

Nhân giống nấm cấp II trên môi trường hạt thóc, que sắn.

Nuôi trồng ra quả thể trên giá thể: 50% mùn cưa cao su, 50% mùn cưa keo tai tượng, bổ sung cám gạo, cám bắp; hấp khử trùng ở 121oC trong 120 phút.

Bịch phôi sau khi cấy giống nấm được đưa vào phòng ủ tơ ở nhiệt độ 23-29oC, độ ẩm không khí 65-72%, tối, thoáng. Sau khi hệ sợi nấm lan kín cơ chất, đưa vào nhà nuôi trồng có nhiệt độ 23-29oC, độ ẩm không khí 85-88%, ánh sáng 500-700 lux.

Phân tích một số hoạt chất cơ bản

Quả thể nấm được gửi phân tích một số hoạt chất cơ bản tại Viện Thực phẩm Chức năng.

Kết quả và thảo luận

Hình thái mẫu nấm

Nấm Linh chi đỏ Quốc Oai được phát hiện ngoài tự nhiên sống hoại sinh hoặc đôi khi ký sinh, mọc đơn hoặc thành cụm trên các khúc gỗ và gốc cây mục nát hoặc từ vết thương của cây sống. Bề mặt quả thể nấm có màu trắng kem đến nâu nhạt khi còn non; nâu đỏ khi trưởng thành. Mũ nấm có kích thước 6 x 12 cm, hình bán nguyệt hoặc hình thận không đều; có chất gỗ; mặt trên mũ nấm bóng, nhẵn, màu nâu đỏ; mặt dưới có màu trắng ngà. Khi trưởng thành, cuống nấm có màu đồng nhất với mũ nấm, hình trụ, dài ≈ 4 cm, đường kính 1-2 cm. Bào tử đảm có hình bầu dục, với đỉnh nhọn, kích thước 13-15,5 x 7,5-9 µm. Bào tử có hình hơi elip, bị cụt một đầu, màu nâu đỏ, kích thước 11-16 x 6-8 µm. Sợi nấm màu trắng mịn, đường kính sợi nấm 1,5 µm. Theo khóa phân loại của Lê Xuân Thám, 1996, 1998, 1999, mẫu nấm Linh chi đỏ thu được ở xã Quốc Oai, huyện Đạ Tẻh thuộc chi Ganoderma.

Mẫu nấm phát hiện ngoài  tự nhiên
Mẫu nấm phát hiện ngoài tự nhiên

Mặt trên và mặt dưới quả thể nấm
Mặt trên và mặt dưới quả thể nấm

Sợi nấm dưới kính hiển vi quang học 40x
Sợi nấm dưới kính hiển vi quang học 40x

Bào tử nấm dưới kính hiển vi quang học 100x
Bào tử nấm dưới kính hiển vi quang học 100x

Hình 1. Một số hình ảnh phân tích hình thái nấm Linh chi đỏ Quốc Oai

Tách phân lập giống

Mẫu nấm LC-QA được tách thành công, phân lập thuần khiết trên môi trường PDA.

Hình 2. Hệ sợi nấm Linh chi đỏ Quốc Oai được tách giống thuần khiết
Hình 2. Hệ sợi nấm Linh chi đỏ Quốc Oai được tách giống thuần khiết

Nhân giống nấm cấp II

Từ kết quả phân lập và nuôi cấy thuần khiết, hệ sợi nấm tiếp tục được nhân giống trên môi trường hạt thóc, que sắn để phục vụ nghiên cứu nuôi trồng.

Kết quả giám định ITS-rDNA

Trình tự ITS- rDNA của mẫu nấm LC-QA được xác định:

TTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCTTTCGCTTGGTGCACTTTCCGGATGACGGGTCAGCATCGATTTTGACCGTCGGAAAAGGGCTGGAGTAATGTGGCACCTCCGGGTGTGTTATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTG

So sánh trình tự thu được từ mẫu LC-QA bằng công cụ BLAST của NCBI cho thấy, mức độ tương đồng về trình tự nucleotide với chủng nấm Ganoderma oregonense là 99% (Hình 3).

Hình 3. So sánh trình tự mẫu LC-QA với các trình tự có trên GenBank
Hình 3. So sánh trình tự mẫu LC-QA với các trình tự có trên GenBank

 Từ kết quả so sánh cho thấy, trình tự gen của mẫu có ký hiệu LC-QA có bậc phân loại gần với loài Ganoderma oregonense (GenBank ID: MH867561.1).

Nuôi trồng ra quả thể

Sau khoảng 35-40 ngày, hệ sợi nấm lan kín cơ chất; sau ≈ 50 ngày, nấm hình thành quả thể; sau ≈ 90 ngày từ khi cấy giống, thu hoạch quả thể nấm.

Hình 4. Các giai đoạn phát triển của quả thể nấm Linh chi đỏ Quốc Oai nuôi trồng
Hình 4. Các giai đoạn phát triển của quả thể nấm Linh chi đỏ Quốc Oai nuôi trồng

Kết quả phân tích hoạt chất

Nấm Linh chi đỏ Quốc Oai được phân tích có hàm lượng Polysaccharide hòa tan tương đương với nấm Linh chi đỏ Đà Lạt; đặc biệt, hàm lượng Adenosine cao gấp 26 lần so với nấm Linh chi đỏ Đà Lạt. Do đó, có khả năng phát triển thành nấm dược liệu quý tại địa phương.

Kết luận và đề nghị

Kết luận

Mẫu nấm LC-QA thu thập ở xã Quốc Oai, huyện Đạ Tẻh, tỉnh Lâm Đồng được giám định là loài nấm Ganoderma oregonense trên cơ sở phân tích hình thái và dẫn liệu ITS-rDNA so với GenBank.

Đã nghiên cứu phân lập, thuần khiết giống nấm Ganoderma oregonense thành công trên môi trường PDA, pH = 6; nuôi cấy ở 30oC. Tốc độ phát triển hệ sợi nấm trung bình đạt 5,63 mm/ngày trên môi trường hạt thóc; 7,38 mm/ngày trên môi trường que sắn.

Bước đầu nuôi trồng thành công trên môi trường 50% mùn cưa cao su, 50% mùn keo tai tượng có bổ sung cám gạo, cám bắp; năng suất quả thể ≈ 15 g khô/bịch phôi (tương đương với nấm Linh chi đỏ Đà Lạt).

Hàm lượng một số hoạt chất cơ bản tương đương với nấm Linh chi đỏ Đà Lạt.

Đề nghị

Tiếp tục bảo tồn và phát triển nguồn gen nấm Linh chi đỏ Quốc Oai, hướng đến chuyển giao, nhân rộng mô hình nhằm tạo vùng nguyên liệu nấm dược liệu quý có nguồn gốc bản địa.

Nghiên cứu sản xuất trà túi lọc và một số thực phẩm chức năng để đáp ứng nhu cầu của khách hàng và chăm sóc sức khỏe cộng đồng.

TÀI LIỆU THAM KHẢO

1. Ngô Anh và cộng sự, Nghiên cứu sự đa dạng về giá trị tài nguyên của khu hệ nấm lớn ở Thừa Thiên - Huế và công nghệ nuôi trồng nấm dược liệu. Tạp chí Khoa học, Đại học Huế 48, 5-14, 2008.

2. A. Trigos và J. S. Medellin, Biologically active metabolites of the genus Ganoderma Three decades of myco-chemistry research. Revisia Mexicana de Micologia 34: 63-83, 2011.

3. Nguyễn Như Chương và cộng sự, Xây dựng mô hình ứng dụng nông nghiệp công nghệ cao nuôi trồng nấm Linh chi đỏ trên hỗn hợp giá thể gỗ quế và nấm Hương tại Đơn Dương, Lạc Dương, tỉnh Lâm Đồng, 2016.

4. S. Singh et al., A novel method of economical cultivation of medicinally important mushroom, Ganoderma lucidum. IJPSR, 5 (5): 2033-2037, 2014.

5. S. Roy et al., Artificial Cultivation of Ganoderma lucidum (Reishi Medicinal Mushroom) Using Different Sawdusts as Substrates. American Journal of BioScience,  3 (5): 178-182, 2015.

6. Lê Xuân Thám, Khóa định loại chi của họ nấm Ganodermataceae Donk. Tạp chí Dược học ISSN 0866-7225, 7, 1996.

7. Lê Xuân Thám, Mycotaxon, 69, 1- 12, 1998.

Số 1/2020

Góp ý của bạn đọc

Nhập mã bảo vệ
Hình ảnh CAPTCHA
Nhập mã Hiển thị ở trên vào hộp dưới đây
HDT HTML
HDT NewsBlog

BẢN TIN KHỞI NGHIỆP ĐỔI MỚI SÁNG TẠO

Số 48/2020 - 21/12/2020
Số 48/2020 Xem thêm
Số 47/2020 - 21/12/2020
Số 46/2020 - 14/12/2020
Số 45/2020 - 14/12/2020
Số 44/2020 - 02/12/2020
HDT HTML
Thống kê truy cập
  • 5.583.240
  • Đang online: 145
  • Trong tuần: 23.219
  • Trong tháng: 133.327
  • Trong năm: 307.304